Stem-loop sequence sko-mir-92a

AccessionMI0010157 (change log)
DescriptionSaccoglossus kowalevskii miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   c     aca  u   gg      c     a a     aa       -  ga 
5'  ucaua   ug cug  gacgcu aggcc g auaag  caauguu gu  u
    |||||   || |||  |||||| ||||| | |||||  ||||||| ||  g
3'  gguau   ac gac  uuguga uccgg c uguuc  guuauaa ca  a
   c     --c  u   -a      a     c c     ac       a  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL015959.1: 55312-55412 [-]
intergenic
Database links

Mature sequence sko-miR-92a

Accession MIMAT0009619
Sequence

61 - 

uauugcacuugucccggccuaa

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).