Stem-loop sequence sko-mir-92b

AccessionMI0010158 (change log)
DescriptionSaccoglossus kowalevskii miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   agcuuuuuucuuu   cg    gua    ua    uuu          uuc 
5'              acc  agcu   aggu  ggac   ugcaauguug   u
                |||  ||||   ||||  ||||   ||||||||||    
3'              ugg  ucgg   uccg  ccug   acguuauaau   c
   ---caacauguau   aa    ucg    gc    uuc          cug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL015959.1: 42157-42257 [-]
intergenic
Clustered miRNAs
< 10kb from sko-mir-92b
sko-mir-92bGL015959.1: 42157-42257 [-]
sko-mir-92cGL015959.1: 40764-40864 [-]
Database links

Mature sequence sko-miR-92b

Accession MIMAT0009620
Sequence

60 - 

uauugcacuugucccggccugc

 - 81

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).