Stem-loop sequence sko-mir-92c

AccessionMI0010159 (change log)
DescriptionSaccoglossus kowalevskii miR-92c stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   accauggauac       -c    g    ua    uuu         uugau 
5'            ugguugg  caug aggu  ggac   ugcaauauu     a
              |||||||  |||| ||||  ||||   |||||||||      
3'            aucaacu  guau uccg  ccug   acguuauaa     u
   ----acauuca       uu    g    gc    cuc         uuuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL015959.1: 40764-40864 [-]
intergenic
Clustered miRNAs
< 10kb from sko-mir-92c
sko-mir-92bGL015959.1: 42157-42257 [-]
sko-mir-92cGL015959.1: 40764-40864 [-]
Database links

Mature sequence sko-miR-92c

Accession MIMAT0009621
Sequence

61 - 

uauugcacucgucccggccugu

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).