Stem-loop sequence sko-mir-124

AccessionMI0010162 (change log)
DescriptionSaccoglossus kowalevskii miR-124 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
   ggauggu      -c      aa        a   gu       guucca 
5'        uauguc  uguucu  guguucac gcg  ccuugau      c
          ||||||  ||||||  |||||||| |||  |||||||      a
3'        auauag  acaaga  cguaagug cgc  ggaauua      c
   -uaaaau      aa      ac        g   ac       acgcaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL018167.1: 335142-335242 [-]
intergenic
Database links

Mature sequence sko-miR-124-5p

Accession MIMAT0009624
Previous IDssko-miR-124*
Sequence

22 - 

aguguucacagcgguccuugau

 - 43

Get sequence
Evidence experimental; 454 [1]

Mature sequence sko-miR-124-3p

Accession MIMAT0009625
Previous IDssko-miR-124
Sequence

61 - 

uaaggcacgcggugaaugccaa

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).