Stem-loop sequence sko-mir-281

AccessionMI0010177 (change log)
DescriptionSaccoglossus kowalevskii miR-281 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   ag    a u   -      u  cg         u g   gc     ua  gc 
5'   gugg g gcu ccuugu gg  aggggagca c cca  gacgg  ug  a
     |||| | ||| |||||| ||  ||||||||| | |||  |||||  ||   
3'   cauu c cga ggaacg cu  uucucucgu g ggu  cuguc  au  c
   -a    a -   u      -  aa         u a   -a     gc  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL011707.1: 217203-217303 [+]
intergenic
Database links

Mature sequence sko-miR-281

Accession MIMAT0009641
Sequence

61 - 

ugucauggaguugcucucuuaa

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).