Stem-loop sequence spu-mir-92a

AccessionMI0010198 (change log)
DescriptionStrongylocentrotus purpuratus miR-92a stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention spu-mir-92a
(1 sentences)

Stem-loop
   ------ac      u    u        u   uc    cc      -ca    u 
5'         gaaucu gucu guaggucg gac  gugc  aauauu   gugu a
           |||||| |||| |||||||| |||  ||||  ||||||   ||||  
3'         cuugga uagg cauccggc cug  cacg  uuauaa   cacg c
   ccucuaau      -    u        c   uu    --      cua    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN917153.1: 419786-419885 [-]
intergenic
Clustered miRNAs
< 10kb from spu-mir-92a
spu-mir-92bKN917153.1: 421925-422025 [-]
spu-mir-92cKN917153.1: 420245-420345 [-]
spu-mir-92aKN917153.1: 419786-419885 [-]
Database links

Mature sequence spu-miR-92a

Accession MIMAT0009662
Sequence

60 - 

uauugcacuugucccggccuacu

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).