Stem-loop sequence aqu-mir-2018

AccessionMI0010226 (change log)
DescriptionAmphimedon queenslandica miR-2018 stem-loop
Stem-loop
   --ca        ga c g            aaa auaa     cg    ---    u        caua         
5'     gugugucg  g c gagguuccggag   g    aagcc  ugca   ggca uggaauga    aaccgguu 
       ||||||||  | | ||||||||||||   |    |||||  ||||   |||| ||||||||    ||||||| g
3'     cacacagc  c g uuccagggccuc   c    uucgg  acgu   uugu accuugcu    uugguuau 
   guga        uc a g            --- --ga     ca    ggu    u        ----         
Get sequence
Deep sequencing
2434 reads, 2.66e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aqu-miR-2018-5p

Accession MIMAT0009694
Previous IDsaqu-miR-2018
Sequence

6 - 

ugucggagccggagguuccgga

 - 27

Get sequence
Deep sequencing2219 reads, 9 experiments
Evidence experimental; 454 [1-2]

Mature sequence aqu-miR-2018-3p

Accession MIMAT0009695
Previous IDsaqu-miR-2018*
Sequence

115 - 

cgggaccuuggaccucgacaca

 - 136

Get sequence
Deep sequencing209 reads, 7 experiments
Evidence experimental; 454 [2]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2
PMID:18830242 "Early origins and evolution of microRNAs and Piwi-interacting RNAs in animals" Grimson A, Srivastava M, Fahey B, Woodcroft BJ, Chiang HR, King N, Degnan BM, Rokhsar DS, Bartel DP Nature. 455:1193-1197(2008).