Stem-loop sequence nve-mir-2024g-1

AccessionMI0010293 (change log)
Previous IDsnve-mir-2024g
DescriptionNematostella vectensis miR-2024g-1 stem-loop
Gene family MIPF0000697; mir-2024
Stem-loop
   accaauaag   -u  -       a             -gg         
5'          ugc  ac ugcuuca aauaucgguguug   uaaaaggu 
            |||  || ||||||| |||||||||||||   ||||||| c
3'          acg  ug acgaagu uuauagccaugac   auuuucca 
   -------aa   uu  c       g             aca         
Get sequence
Deep sequencing
185507 reads, 9.84e+04 reads per million, 23 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI1.0) Overlapping transcripts
scaffold_282: 93047-93135 [-]
intergenic
Clustered miRNAs
< 10kb from nve-mir-2024g-1
nve-mir-2024e-2scaffold_282: 94237-94330 [-]
nve-mir-2024g-2scaffold_282: 93997-94085 [-]
nve-mir-2024e-1scaffold_282: 93287-93380 [-]
nve-mir-2024g-1scaffold_282: 93047-93135 [-]
Database links

Mature sequence nve-miR-2024g-5p

Accession MIMAT0009774
Previous IDsnve-miR-2024g*
Sequence

22 - 

aaaauaucgguguuggguaaa

 - 42

Get sequence
Deep sequencing31977 reads, 23 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence nve-miR-2024g-3p

Accession MIMAT0009775
Previous IDsnve-miR-2024g
Sequence

54 - 

uaacacaguaccgauauuguga

 - 75

Get sequence
Deep sequencing524535 reads, 23 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:18830242 "Early origins and evolution of microRNAs and Piwi-interacting RNAs in animals" Grimson A, Srivastava M, Fahey B, Woodcroft BJ, Chiang HR, King N, Degnan BM, Rokhsar DS, Bartel DP Nature. 455:1193-1197(2008).
2
PMID:24642861 "Cnidarian microRNAs frequently regulate targets by cleavage" Moran Y, Fredman D, Praher D, Li XZ, Wee LM, Rentzsch F, Zamore PD, Technau U, Seitz H Genome Res. 24:651-663(2014).