Stem-loop sequence nve-mir-2031

AccessionMI0010297 (change log)
DescriptionNematostella vectensis miR-2031 stem-loop
Stem-loop
   -a                                   u 
5'   gaccaccuaaaauacggcacucuauuuaugguacu u
     |||||||||||||||||||||||||||||||||||  
3'   uugguggauuuuaugccgugagauaaauaccauga u
   aa                                   a 
Get sequence
Deep sequencing
1373 reads, 1.32e+03 reads per million, 21 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI1.0) Overlapping transcripts
scaffold_48: 869417-869493 [+]
intergenic
Database links

Mature sequence nve-miR-2031-5p

Accession MIMAT0009782
Previous IDsnve-miR-2031
Sequence

14 - 

uacggcacucuauuuaugguacu

 - 36

Get sequence
Deep sequencing968 reads, 21 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence nve-miR-2031-3p

Accession MIMAT0009783
Previous IDsnve-miR-2031*
Sequence

43 - 

uaccauaaauagagugccguauu

 - 65

Get sequence
Deep sequencing402 reads, 15 experiments
Evidence experimental; 454 [1]

References

1
PMID:18830242 "Early origins and evolution of microRNAs and Piwi-interacting RNAs in animals" Grimson A, Srivastava M, Fahey B, Woodcroft BJ, Chiang HR, King N, Degnan BM, Rokhsar DS, Bartel DP Nature. 455:1193-1197(2008).
2
PMID:24642861 "Cnidarian microRNAs frequently regulate targets by cleavage" Moran Y, Fredman D, Praher D, Li XZ, Wee LM, Rentzsch F, Zamore PD, Technau U, Seitz H Genome Res. 24:651-663(2014).