Stem-loop sequence nve-mir-2042

AccessionMI0010309 (change log)
DescriptionNematostella vectensis miR-2042 stem-loop
Stem-loop
   uuuacaauga         c            cu  c  u  u 
5'           cgacacacc uuauaaaucauc  ug ac ac u
             ||||||||| ||||||||||||  || || ||  
3'           guugugugg aguauuuaguag  ac ug ug a
   cgucucaguc         a            uu  a  c  u 
Get sequence
Deep sequencing
745 reads, 410 reads per million, 20 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI1.0) Overlapping transcripts
scaffold_231: 5526-5613 [-]
intergenic
Clustered miRNAs
< 10kb from nve-mir-2042
nve-mir-2042scaffold_231: 5526-5613 [-]
nve-mir-2051scaffold_231: 5180-5273 [-]
Database links

Mature sequence nve-miR-2042-5p

Accession MIMAT0009806
Previous IDsnve-miR-2042
Sequence

21 - 

uuauaaaucauccuugcacuac

 - 42

Get sequence
Deep sequencing437 reads, 18 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence nve-miR-2042-3p

Accession MIMAT0009807
Previous IDsnve-miR-2042*
Sequence

49 - 

cguacauugaugauuuaugaag

 - 70

Get sequence
Deep sequencing308 reads, 15 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:18830242 "Early origins and evolution of microRNAs and Piwi-interacting RNAs in animals" Grimson A, Srivastava M, Fahey B, Woodcroft BJ, Chiang HR, King N, Degnan BM, Rokhsar DS, Bartel DP Nature. 455:1193-1197(2008).
2
PMID:24642861 "Cnidarian microRNAs frequently regulate targets by cleavage" Moran Y, Fredman D, Praher D, Li XZ, Wee LM, Rentzsch F, Zamore PD, Technau U, Seitz H Genome Res. 24:651-663(2014).