Stem-loop sequence cfa-mir-490

AccessionMI0010372 (change log)
DescriptionCanis familiaris miR-490 stem-loop
Gene family MIPF0000229; mir-490
Stem-loop
   aaaguucauugu      c      --         g   cac   u 
5'             ucgaca caugga  ucuccaggu ggu   guu a
               |||||| ||||||  ||||||||| |||   |||  
3'             aguugu guaccu  ggaggucca cca   uag g
   ------------      c      ca         a   -ca   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr16: 11628312-11628392 [-]
intergenic
Database links

Mature sequence cfa-miR-490

Accession MIMAT0009875
Sequence

56 - 

caaccuggaggacuccaugcug

 - 77

Get sequence
Evidence by similarity; MI0005002
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).