Stem-loop sequence cfa-mir-141

AccessionMI0010374 (change log)
DescriptionCanis familiaris miR-141 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   g    cucu   u       --    u        -   ugg  ua 
5'  ccgg    ggg ccaucuu  ccag acaguguu gga   uc  g
    ||||    ||| |||||||  |||| |||||||| |||   ||  u
3'  ggcc    ccc gguagaa  gguc ugucacaa ccu   ag  c
   g    ----   -       au    -        u   cga  ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr27: 38081668-38081753 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-141
cfa-mir-200cchr27: 38082097-38082159 [-]
cfa-mir-141chr27: 38081668-38081753 [-]
Database links

Mature sequence cfa-miR-141

Accession MIMAT0009876
Sequence

58 - 

aacacugucugguaaagaugg

 - 78

Get sequence
Evidence by similarity; MI0002487
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).