Stem-loop sequence cfa-mir-331

AccessionMI0010394 (change log)
DescriptionCanis familiaris miR-331 stem-loop
Gene family MIPF0000199; mir-331
Stem-loop
   gaguuugguuuugu       u        u    u       au ccaga 
5'               uuggguu guucuagg augg cccaggg  c     u
                 ||||||| |||||||| |||| |||||||  |     c
3'               aauccaa caagaucc uauc ggguccc  g     a
   --------------       c        -    c       cg accaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr15: 35234750-35234839 [+]
sense
ENSCAFT00000032739 ; cfa-mir-331-201; exon 1
Database links

Mature sequence cfa-miR-331

Accession MIMAT0009895
Sequence

61 - 

gccccugggccuauccuagaa

 - 81

Get sequence
Evidence by similarity; MI0005463
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).