Stem-loop sequence bfl-mir-2059

AccessionMI0010494 (change log)
DescriptionBranchiostoma floridae miR-2059 stem-loop
Gene family MIPF0001683; mir-2059
Stem-loop
   cauuuguguuggacc              uu c          u  a 
5'                ccuuucaaggcaaa  g ugcaauacuu gu u
                  ||||||||||||||  | |||||||||| || c
3'                ggaaaguuucguuu  u acguuaugaa cg c
   --------------u              uu c          -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666525.1: 1619205-1619286 [+]
intergenic
Database links

Mature sequence bfl-miR-2059-5p

Accession MIMAT0019168
Sequence

21 - 

caaggcaaauugcugcaauacu

 - 42

Get sequence
Evidence experimental; 454 [2]

Mature sequence bfl-miR-2059-3p

Accession MIMAT0009985
Previous IDsbfl-miR-2059
Sequence

57 - 

uauugcacuuuuuugcuuuga

 - 77

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
2
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).