Stem-loop sequence bfl-mir-2063

AccessionMI0010498 (change log)
DescriptionBranchiostoma floridae miR-2063 stem-loop
Gene family MIPF0001752; mir-2063
Stem-loop
   aggcu           a     -a   u        ggua    ac 
5'      cacuuucaaaa gcaaa  agu gcaauauc    uacg  g
        ||||||||||| |||||  ||| ||||||||    ||||   
3'      gugaaaguuuu cguuu  uca cguuauag    augc  u
   -----           -     aa   -        ----    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666639.1: 848285-848366 [-]
intergenic
Database links

Mature sequence bfl-miR-2063

Accession MIMAT0009989
Sequence

56 - 

uauugcacuaauuugcuuuuga

 - 77

Get sequence
Evidence experimental; cloned [1]

References

1