Stem-loop sequence lmi-mir-281

AccessionMI0010642 (change log)
DescriptionLocusta migratoria miR-281 stem-loop
Gene family MIPF0000087; mir-46
Literature search

1 open access papers mention lmi-mir-281
(2 sentences)

Stem-loop
   ---        -ua     c      --  a 
5'    aagagagc   uccgu gacagu  ac g
      ||||||||   ||||| ||||||  || u
3'    uucucucg   aggua cuguca  ug g
   aau        uug     -      aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lmi-miR-281-5p

Accession MIMAT0010140
Previous IDslmi-miR-281*
Sequence

1 - 

aagagagcuauccgucgacagu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence lmi-miR-281-3p

Accession MIMAT0010141
Previous IDslmi-miR-281
Sequence

36 - 

ugucauggaguugcucucuuuaa

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1