Stem-loop sequence sme-mir-2151

AccessionMI0010772 (change log)
DescriptionSchmidtea mediterranea miR-2151 stem-loop
Stem-loop
   u   --ua      cu  uuaca         a    g      a 
5'  gcu    agagaa  cu     gaucauguu agug aauuug u
    |||    ||||||  ||     ||||||||| |||| ||||||  
3'  cga    ucucuu  ga     cugguauaa ucac uuagac a
   a   caac      uc  uuaga         c    g      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig2742: 61491-61580 [+]
intergenic
Database links

Mature sequence sme-miR-2151-5p

Accession MIMAT0012135
Previous IDssme-miR-2151*
Sequence

20 - 

cagaucauguuaaguggaauuugau

 - 44

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-2151-3p

Accession MIMAT0011232
Previous IDssme-miR-2151
Sequence

49 - 

gauugcacucaauauggucagau

 - 71

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).