Stem-loop sequence sme-mir-2167

AccessionMI0010805 (change log)
DescriptionSchmidtea mediterranea miR-2167 stem-loop
Stem-loop
   ---ugug    c     uau           a  u    u    u   -a   u 
5'        aaug aauuc   cuuugaaagac ag cuua acau cuu  gug c
          |||| |||||   ||||||||||| || |||| |||| |||  ||| a
3'        uugc uuaag   gagacuuucug uc gaau ugug gaa  uac a
   cugcuaa    -     uac           g  -    -    u   cc   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig272: 56602-56705 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-2167
sme-mir-2167Contig272: 56602-56705 [-]
sme-mir-2fContig272: 56513-56575 [-]
sme-mir-2eContig272: 56381-56476 [-]
Database links

Mature sequence sme-miR-2167

Accession MIMAT0011264
Sequence

63 - 

uguguuaagcuggucuuucaga

 - 84

Get sequence
Evidence experimental; 454 [1], Illumina [1]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).