Stem-loop sequence sbi-MIR821a

AccessionMI0010925 (change log)
DescriptionSorghum bicolor miR821a stem-loop
Gene family MIPF0000350; MIR821
Stem-loop
             c  cuaaa     c  c  c   a        a    g          c             a  c    u     a                                            g        u 
5' uaaaugauuu ag     aaagu au aa aua aaguugua aacu gucaagaucu caauuuuuauuuu gu auuu uucau ugacaaaguaauaguaacauuguucauaaauuuuacauaucucu auauaguu c
   |||||||||| ||     ||||| || || ||| |||||||| |||| |||||||||| ||||||||||||| || |||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| a
3' auuuacuaaa uc     uuuca ua uu uau uucaacau uuga uaguucuaga guugaaaauaaaa ca uaaa aagua gcuguuucauuaucauuguaacaaguauuuaaaauguauagaga uauaucaa u
             a  aacua     a  c  a   g        g    g          u             c  a    u     g                                            g        a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 54242214-54242498 [+]
intergenic
Database links

Mature sequence sbi-miR821a

Accession MIMAT0011385
Sequence

20 - 

aagucaucaacauaaaaguug

 - 40

Get sequence
Evidence by similarity; MI0005267

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).