Stem-loop sequence sbi-MIR821c

AccessionMI0010927 (change log)
DescriptionSorghum bicolor miR821c stem-loop
Gene family MIPF0000350; MIR821
Stem-loop
                cuaaa        c  c   a        g    g          c             a       u     a  a                   g                     g        u 
5' uaaaugauuuuag     aaagucau aa aua aaguugua aacu gucaagaucu uaauuuuuauuuu gucauuu uucau ug caaaguaauaguaacauug ucauaaauuuuacauaucucu auauaguu c
   |||||||||||||     |||||||| || ||| |||||||| |||| |||||||||| ||||||||||||| ||||||| ||||| || ||||||||||||||||||| ||||||||||||||||||||| |||||||| a
3' auuuacuaaaauc     uuucagua uu uau uucaacau uuga uaguucuaga guugaaaauaaga caguaaa aagua gc guuucauuaucauuguaac aguauuuaaaauguauagaga uauaucaa u
                cacua        c  a   g        g    g          u             c       u     g  c                   a                     g        a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 60192684-60192968 [+]
intergenic
Database links

Mature sequence sbi-miR821c

Accession MIMAT0011387
Sequence

20 - 

aagucaucaacauaaaaguug

 - 40

Get sequence
Evidence by similarity; MI0005267

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).