Stem-loop sequence sbi-MIR821d

AccessionMI0010928 (change log)
DescriptionSorghum bicolor miR821d stem-loop
Gene family MIPF0000350; MIR821
Stem-loop
   -----------     g    c    ac            a          c  a              uc    auc       u          c  c            u      a   c   g       u 
5'            aaaaa ucau aaca  aaaguuguagaa ucauuaauau ua aacuuuuauuuugg  auuu   cauucga aaagugauag aa auuguucauaaa uuuaca auc cuc uaugguu c
              ||||| |||| ||||  |||||||||||| |||||||||| || ||||||||||||||  ||||   ||||||| |||||||||| || |||||||||||| |||||| ||| ||| ||||||| a
3'            uuuuu agua uugu  uuucaacaucuu aguaguuaua au uugaaaauaaaauc  uaaa   guaggcu uuucacuauc uu uaacaaguguuu aaaugu uag gag auaucaa u
   cuaaaguaagc     a    c    au            g          u  g              ca    caa       c          a  a            u      a   a   a       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 29629764-29630027 [+]
intergenic
Database links

Mature sequence sbi-miR821d

Accession MIMAT0011388
Sequence

4 - 

aagucaucaacaacaaaguug

 - 24

Get sequence
Evidence by similarity; MI0005266

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).