Stem-loop sequence sbi-MIR821e

AccessionMI0010929 (change log)
DescriptionSorghum bicolor miR821e stem-loop
Gene family MIPF0000350; MIR821
Stem-loop
   ----------------aa        c  a   a        g    a          c c           a       u     a                                            g        u 
5'                   aaagucau aa aua aaguugua aacu gucaagaucu c auuuuuauuuu gucauuu uucau ugacaaaguaauaguaacauuguucauaaauuuuacauaucucu auauaguu a
                     |||||||| || ||| |||||||| |||| |||||||||| | ||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| u
3'                   uuucggua uu uau uucaacau uuga uaguucuaga g ugaaaauaaaa uaguaaa aagua acuguuucauuaucauuguaacaaguauuuaaaauguauagaga uauaucaa g
   auuuacuaaaaucaacua        c  a   g        g    g          u u           c       u     g                                            g        a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr9: 44973965-44974233 [-]
intergenic
Database links

Mature sequence sbi-miR821e

Accession MIMAT0011389
Sequence

4 - 

aagucaucaaaauaaaaguug

 - 24

Get sequence
Evidence by similarity; MI0005266

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).