Stem-loop sequence cbr-mir-235b

AccessionMI0010983 (change log)
DescriptionCaenorhabditis briggsae miR-235b stem-loop
Stem-loop
   ----------ucugaaauc      c     c      u     u      c  ua 
5'                    uuggau aggcu ugguca gugca auauug gc  u
                      |||||| ||||| |||||| ||||| |||||| ||  a
3'                    gaucug uccgg accagu cacgu uauaau cg  u
   agacuuugacagaaugaaa      c     u      u     -      -  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrI: 10817837-10817939 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-235b
cbr-mir-235bchrI: 10817837-10817939 [-]
cbr-mir-235achrI: 10817705-10817786 [-]
Database links

Mature sequence cbr-miR-235b-5p

Accession MIMAT0011473
Previous IDscbr-miR-235b*
Sequence

17 - 

aggcucuggucaugugcauauauu

 - 40

Get sequence
Evidence experimental; 454 [1]

Mature sequence cbr-miR-235b-3p

Accession MIMAT0011474
Previous IDscbr-miR-235b
Sequence

57 - 

uauugcacuugaccauggccu

 - 77

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).