Stem-loop sequence cbr-mir-56

AccessionMI0010984 (change log)
DescriptionCaenorhabditis briggsae miR-56 stem-loop
Stem-loop
   -    -a   a  au     ucu            uc    uc   uu     uc    caa 
5'  ugga  cgg ac  caguu   guucucagggga  cagu  cgg  gugcc  aucu   u
    ||||  ||| ||  |||||   ||||||||||||  ||||  |||  |||||  ||||    
3'  acuu  gcc ug  gucag   uaagagucuccu  guua  gcc  cacgg  uaga   a
   g    ac   a  -c     --c            uc    -u   --     --    ccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 16963326-16963441 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-56
cbr-mir-54dchrX: 16964062-16964175 [-]
cbr-mir-54cchrX: 16963921-16964016 [-]
cbr-mir-54achrX: 16963746-16963863 [-]
cbr-mir-54bchrX: 16963589-16963700 [-]
cbr-mir-55chrX: 16963456-16963567 [-]
cbr-mir-56chrX: 16963326-16963441 [-]
Database links

Mature sequence cbr-miR-56-5p

Accession MIMAT0011475
Previous IDscbr-miR-56*
Sequence

27 - 

caggggauccaguuccgguugugcc

 - 51

Get sequence
Evidence experimental; 454 [1]

Mature sequence cbr-miR-56-3p

Accession MIMAT0011476
Previous IDscbr-miR-56
Sequence

72 - 

cacccguauugcuuccucugag

 - 93

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).