Stem-loop sequence cbr-mir-65

AccessionMI0011002 (change log)
DescriptionCaenorhabditis briggsae miR-65 stem-loop
Stem-loop
   -    ----  u      uc           g g  aau    gc       
5'  agac    cc caccaa  augacacugaa c gg   ggaa  guaguc 
    ||||    || ||||||  ||||||||||| | ||   ||||  ||||| a
3'  ucug    gg gugguu  uacugugacuu g cc   ccuu  cguuag 
   g    agua  c      ca           g g  -au    aa       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrIII: 868808-868904 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-65
cbr-mir-2226chrIII: 869446-869544 [-]
cbr-mir-64cchrIII: 869360-869420 [-]
cbr-mir-64achrIII: 869205-869314 [-]
cbr-mir-64bchrIII: 869080-869196 [-]
cbr-mir-65chrIII: 868808-868904 [-]
Database links

Mature sequence cbr-miR-65-5p

Accession MIMAT0011484
Previous IDscbr-miR-65
Sequence

15 - 

caugacacugaagcgggaaugg

 - 36

Get sequence
Evidence experimental; 454 [1]

Mature sequence cbr-miR-65-3p

Accession MIMAT0011485
Previous IDscbr-miR-65*
Sequence

58 - 

ccuaccggguucagugucauacu

 - 80

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).