Stem-loop sequence crm-mir-64d

AccessionMI0011092 (change log)
DescriptionCaenorhabditis remanei miR-64d stem-loop
Gene family MIPF0000295; mir-64
Literature search

1 open access papers mention crm-mir-64d
(17 sentences)

Stem-loop
      g   u a cc    ugcuu               aa  c      u   -  gaua 
5' uca agu c g  gccc     gccagcuaugacacu  ag guagca gga cc    g
   ||| ||| | |  ||||     |||||||||||||||  || |||||| ||| ||     
3' agu ucg g c  uggg     cggucgguacugugg  uc cauugu ccu gg    a
      g   u c ua    --uuu               ag  -      -   a  gaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig41: 72472-72586 [+]
intergenic
Clustered miRNAs
< 10kb from crm-mir-64d
crm-mir-7613Crem_Contig41: 71834-71894 [+]
crm-mir-64aCrem_Contig41: 71965-72073 [+]
crm-mir-66Crem_Contig41: 72081-72200 [+]
crm-mir-64bCrem_Contig41: 72225-72316 [+]
crm-mir-64cCrem_Contig41: 72317-72434 [+]
crm-mir-64dCrem_Contig41: 72472-72586 [+]
crm-mir-64eCrem_Contig41: 72615-72729 [+]
Database links

Mature sequence crm-miR-64d-5p

Accession MIMAT0011593
Previous IDscrm-miR-64d
Sequence

29 - 

uaugacacuaaagcguagcaugg

 - 51

Get sequence
Evidence experimental; 454 [1]

Mature sequence crm-miR-64d-3p

Accession MIMAT0011594
Previous IDscrm-miR-64d*
Sequence

70 - 

cuguuaccugaggugucauggc

 - 91

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).