Stem-loop sequence crm-mir-46

AccessionMI0011094 (change log)
DescriptionCaenorhabditis remanei miR-46 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   -    gaaua      gguaaag           -cg     u      u   uucu 
5'  aacc     agagga       cugaagagagc   ucuau gacagu cgu    a
    ||||     ||||||       |||||||||||   ||||| |||||| |||     
3'  uugg     uuuccu       gacuucucucg   aggua cuguca gua    u
   u    --aac      ---agua           cug     -      u   uuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig12: 1283899-1284006 [-]
intergenic
Database links

Mature sequence crm-miR-46-5p

Accession MIMAT0011597
Previous IDscrm-miR-46*
Sequence

26 - 

aagagagccgucuauugacagu

 - 47

Get sequence
Evidence experimental; 454 [1]

Mature sequence crm-miR-46-3p

Accession MIMAT0011598
Previous IDscrm-miR-46
Sequence

68 - 

ugucauggagucgcucucuuc

 - 88

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).