Stem-loop sequence crm-mir-63

AccessionMI0011116 (change log)
DescriptionCaenorhabditis remanei miR-63 stem-loop
Gene family MIPF0000823; mir-63
Stem-loop
   uuc u   acaugu     aa  u   c           --    a     u     - auaaa 
5'    c cca      cagaa  ca cca uucuaacucgu  cggu gucau guuuc c     c
      | |||      |||||  || ||| |||||||||||  |||| ||||| ||||| |      
3'    g ggu      gucuu  gu ggu aagauugagcg  guca cagua caaag g     c
   gaa c   ------     -a  -   a           aa    -     u     u aagga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig50: 453664-453781 [+]
intergenic
Database links

Mature sequence crm-miR-63-5p

Accession MIMAT0011622
Previous IDscrm-miR-63
Sequence

30 - 

ucuaacucgucgguagucauuguu

 - 53

Get sequence
Evidence experimental; 454 [1]

Mature sequence crm-miR-63-3p

Accession MIMAT0011623
Previous IDscrm-miR-63*
Sequence

76 - 

uaugacacugaagcgaguuag

 - 96

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).