Stem-loop sequence crm-mir-64e

AccessionMI0011121 (change log)
DescriptionCaenorhabditis remanei miR-64e stem-loop
Literature search

1 open access papers mention crm-mir-64e
(17 sentences)

Stem-loop
       -  -ccaa    cc     c   u    c   gua       c   uaauag   a 
5' acgg ac     agga  ccacc ggc auga acu   acauguc ugg      cag g
   |||| ||     ||||  ||||| ||| |||| |||   ||||||| |||      ||| a
3' uguu ug     uccu  ggugg ucg uacu uga   uguacag acc      guc u
       a  uuaag    cu     -   u    u   -aa       -   ---uaa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig41: 72615-72729 [+]
intergenic
Clustered miRNAs
< 10kb from crm-mir-64e
crm-mir-7613Crem_Contig41: 71834-71894 [+]
crm-mir-64aCrem_Contig41: 71965-72073 [+]
crm-mir-66Crem_Contig41: 72081-72200 [+]
crm-mir-64bCrem_Contig41: 72225-72316 [+]
crm-mir-64cCrem_Contig41: 72317-72434 [+]
crm-mir-64dCrem_Contig41: 72472-72586 [+]
crm-mir-64eCrem_Contig41: 72615-72729 [+]
Database links

Mature sequence crm-miR-64e

Accession MIMAT0011628
Sequence

26 - 

uaugacacuguaacauguccugg

 - 48

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).