Stem-loop sequence crm-mir-66

AccessionMI0011125 (change log)
DescriptionCaenorhabditis remanei miR-66 stem-loop
Stem-loop
      - -    -gaaaa     caa       ca      a a       a     - -    aa 
5' ucc c accg      gaaca   agccaug  ugacac g uuaaagg uguga c acuu  c
   ||| | ||||      |||||   |||||||  |||||| | ||||||| ||||| | ||||   
3' agg g uggc      cuugu   ucgguac  acugug c gauuucc acacu g ugaa  a
      a a    augagg     ---       ag      c -       -     a a    ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig41: 72081-72200 [+]
intergenic
Clustered miRNAs
< 10kb from crm-mir-66
crm-mir-7613Crem_Contig41: 71834-71894 [+]
crm-mir-64aCrem_Contig41: 71965-72073 [+]
crm-mir-66Crem_Contig41: 72081-72200 [+]
crm-mir-64bCrem_Contig41: 72225-72316 [+]
crm-mir-64cCrem_Contig41: 72317-72434 [+]
crm-mir-64dCrem_Contig41: 72472-72586 [+]
crm-mir-64eCrem_Contig41: 72615-72729 [+]
Database links

Mature sequence crm-miR-66-5p

Accession MIMAT0011635
Previous IDscrm-miR-66
Sequence

29 - 

caugacacagauuaaaggaugug

 - 51

Get sequence
Evidence experimental; 454 [1]

Mature sequence crm-miR-66-3p

Accession MIMAT0011636
Previous IDscrm-miR-66*
Sequence

73 - 

acaccuuuagccgugucagac

 - 93

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).