Stem-loop sequence crm-mir-64b

AccessionMI0011126 (change log)
DescriptionCaenorhabditis remanei miR-64b stem-loop
Gene family MIPF0000967; mir-64_2
Literature search

1 open access papers mention crm-mir-64b
(18 sentences)

Stem-loop
   -     -         c        c  g     c     --   acu 
5'  ggggc cucgccgau augacacu aa cauac augga  cug   u
    ||||| ||||||||| |||||||| || ||||| |||||  |||    
3'  ccccg gagcggcua uauuguga uu guaug uaccu  gac   u
   c     u         c        -  g     -     aa   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig41: 72225-72316 [+]
intergenic
Clustered miRNAs
< 10kb from crm-mir-64b
crm-mir-7613Crem_Contig41: 71834-71894 [+]
crm-mir-64aCrem_Contig41: 71965-72073 [+]
crm-mir-66Crem_Contig41: 72081-72200 [+]
crm-mir-64bCrem_Contig41: 72225-72316 [+]
crm-mir-64cCrem_Contig41: 72317-72434 [+]
crm-mir-64dCrem_Contig41: 72472-72586 [+]
crm-mir-64eCrem_Contig41: 72615-72729 [+]
Database links

Mature sequence crm-miR-64b-5p

Accession MIMAT0011637
Previous IDscrm-miR-64b
Sequence

15 - 

caugacacucaagcauaccaugg

 - 37

Get sequence
Evidence experimental; 454 [1]

Mature sequence crm-miR-64b-3p

Accession MIMAT0011638
Previous IDscrm-miR-64b*
Sequence

57 - 

cauguaugguuaguguuaucau

 - 78

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).