Stem-loop sequence ppc-mir-63b

AccessionMI0011138 (change log)
DescriptionPristionchus pacificus miR-63b stem-loop
Gene family MIPF0000823; mir-63
Stem-loop
        aucc      -uc c    a       c      a    u     u    -  guu 
5' gaacu    gaucca   g ucac ugggaac cucucg cuuu guguc uaga cu   u
   |||||    ||||||   | |||| ||||||| |||||| |||| ||||| |||| ||   c
3' cuuga    cugggu   c agug acccuug gagagc gaag cacag aucu ga   g
        ----      uuu a    -       u      -    u     u    u  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ppc-miR-63b

Accession MIMAT0011650
Sequence

71 - 

uaugacacugaagcgagagugu

 - 92

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).