Stem-loop sequence ppc-mir-63a

AccessionMI0011150 (change log)
DescriptionPristionchus pacificus miR-63a stem-loop
Gene family MIPF0000823; mir-63
Stem-loop
   u       c   -aa   -      a     c  u     g   ug  u     -ug   acu 
5'  cucuccc ucu   ucc ccccuu gccgu cc ucucg cuu  gu gucau   ucu   u
    ||||||| |||   ||| |||||| ||||| || ||||| |||  || |||||   |||    
3'  gggaggg aga   agg ggggag cggca gg agagc gaa  ca cagua   aga   g
   -       -   agg   a      -     u  u     -   gu  -     uca   gaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000119.1: 561812-561931 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-63a
ppc-mir-63aABKE03000119.1: 561812-561931 [+]
ppc-mir-2232-1ABKE03000119.1: 562163-562262 [+]
Database links

Mature sequence ppc-miR-63a

Accession MIMAT0011658
Sequence

71 - 

uaugacacugaagcgagauggu

 - 92

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).