Stem-loop sequence ppc-mir-63d

AccessionMI0011152 (change log)
DescriptionPristionchus pacificus miR-63d stem-loop
Gene family MIPF0000823; mir-63
Stem-loop
   c     uggc    cuuuuuu     c         uu  c        -  ucau 
5'  cuccc    ccgu       uuucu cguucgcuu  gg gucauggu cc    u
    |||||    ||||       ||||| |||||||||  || |||||||| ||    u
3'  gaggg    ggca       agaga gcgagcgaa  uc caguauca gg    g
   -     ---u    -------     a         -c  a        u  ucgg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000028.1: 915392-915493 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-63d
ppc-mir-63gABKE03000028.1: 914719-914813 [+]
ppc-mir-63iABKE03000028.1: 915024-915086 [+]
ppc-mir-63hABKE03000028.1: 915178-915286 [+]
ppc-mir-63dABKE03000028.1: 915392-915493 [+]
ppc-mir-63kABKE03000028.1: 915983-916046 [+]
ppc-mir-63eABKE03000028.1: 916252-916352 [+]
Database links

Mature sequence ppc-miR-63d

Accession MIMAT0011660
Sequence

68 - 

uaugacacucaagcgagcgaag

 - 89

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).