Stem-loop sequence ppc-mir-2258

AccessionMI0011162 (change log)
DescriptionPristionchus pacificus miR-2258 stem-loop
Stem-loop
   u   ucu   ----au     uc       c         --       u  c  u  a 
5'  cuc   cug      cucaa  gggaguu cgguuucgu  ugguguc au uc ac g
    |||   |||      |||||  ||||||| |||||||||  ||||||| || || || a
3'  gag   gau      gaguu  cccuuaa gccaaagcg  accacag ua ag ug a
   -   -uu   guagau     -c       c         aa       -  a  u  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000092.1: 345785-345895 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-2258
ppc-mir-2258ABKE03000092.1: 345785-345895 [+]
ppc-mir-8213ABKE03000092.1: 346957-347019 [+]
ppc-mir-8241ABKE03000092.1: 347184-347246 [+]
Database links

Mature sequence ppc-miR-2258

Accession MIMAT0011669
Sequence

63 - 

aaugacaccaaagcgaaaccgc

 - 84

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).