Stem-loop sequence ppc-mir-2255

AccessionMI0011172 (change log)
DescriptionPristionchus pacificus miR-2255 stem-loop
Stem-loop
       uugccccuuc            u      a    c   u   g 
5' gagc          uugccaauacua ucaaug caau uaa ccg u
   ||||          |||||||||||| |||||| |||| ||| |||  
3' cucg          aacgguuauggu aguuac guua auu ggu a
       --------ca            u      -    a   -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000104.1: 1644164-1644249 [-]
intergenic
Database links

Mature sequence ppc-miR-2255

Accession MIMAT0011679
Sequence

57 - 

aauugcauugauugguauuggc

 - 78

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).