Stem-loop sequence ppc-mir-2238b-1

AccessionMI0011182 (change log)
DescriptionPristionchus pacificus miR-2238b-1 stem-loop
Gene family MIPF0000822; mir-2238
Stem-loop
   -  cu   u    - u     gccua    c gu      cu  c         ugau 
5'  cc  cca ggaa c agucu     cuuc c  cuacuc  uu gucauucgu    a
    ||  ||| |||| | |||||     |||| |  ||||||  || |||||||||     
3'  gg  ggu ccuu g ucaga     gaag g  ggugag  aa caguaagca    c
   u  uu   u    c u     ---ag    a ug      cu  -         uaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000059.1: 713454-713565 [-]
intergenic
Database links

Mature sequence ppc-miR-2238b

Accession MIMAT0011682
Sequence

66 - 

aaugacaaucgagugggugag

 - 86

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).