Stem-loop sequence ppc-mir-2238a-1

AccessionMI0011193 (change log)
DescriptionPristionchus pacificus miR-2238a-1 stem-loop
Gene family MIPF0000822; mir-2238
Stem-loop
   -    ---      uaa      a     c    c uuuu    c    c    a    uaau 
5'  cggu   uuaugg   cuaguc uuccu uuuc c    cacu aucu guca ucga    u
    ||||   ||||||   |||||| ||||| |||| |    |||| |||| |||| ||||     
3'  guca   aaugcc   gaucag aagga agag g    guga uaga cagu agcu    g
   g    cau      uuc      -     -    c ---c    c    -    a    uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000048.1: 448529-448646 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-2238a-1
ppc-mir-2238iABKE03000048.1: 447717-447778 [+]
ppc-mir-2238a-1ABKE03000048.1: 448529-448646 [+]
Database links

Mature sequence ppc-miR-2238a

Accession MIMAT0011692
Sequence

69 - 

aaugacagaucagugcgcgag

 - 89

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).