Stem-loop sequence ppc-mir-2238c

AccessionMI0011196 (change log)
DescriptionPristionchus pacificus miR-2238c stem-loop
Gene family MIPF0000822; mir-2238
Stem-loop
   -     au c      gaucc      c   u    -c    c    g    uga 
5'  uuaug  a cuaguc     ucuuuc cgu cacu  uucu guca ucga   u
    |||||  | ||||||     |||||| ||| ||||  |||| |||| ||||   g
3'  agugc  u gaucag     aggaag gcg guga  aaga cagu agcu   a
   u     cu c      ----a      a   c    ac    -    a    uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000093.1: 8986518-8986623 [+]
intergenic
Database links

Mature sequence ppc-miR-2238c

Accession MIMAT0011693
Sequence

63 - 

aaugacagaacaagugcgcgag

 - 84

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).