Stem-loop sequence ppc-mir-2238d

AccessionMI0011213 (change log)
DescriptionPristionchus pacificus miR-2238d stem-loop
Gene family MIPF0000822; mir-2238
Stem-loop
   -       a c    aauuc          cg  c   a     a    ugau 
5'  uuuaccg g aguc     ccuuuucguu  cu cac uguca ucgu    u
    ||||||| | ||||     ||||||||||  || ||| ||||| ||||     
3'  aaguggc c ucag     ggaagagcgg  ga gug acagu agca    c
   c       - -    ---au          ua  c   a     a    ugag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000020.1: 187290-187391 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-2238d
ppc-mir-2238dABKE03000020.1: 187290-187391 [+]
ppc-mir-2238jABKE03000020.1: 188103-188162 [+]
Database links

Mature sequence ppc-miR-2238d

Accession MIMAT0011710
Sequence

62 - 

aaugacaagugcagauggcgag

 - 83

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).