Stem-loop sequence ppc-mir-2238e

AccessionMI0011223 (change log)
DescriptionPristionchus pacificus miR-2238e stem-loop
Gene family MIPF0000822; mir-2238
Stem-loop
     uac       uuuc      c   u    c    c    -------g   a 
5' gg   cuagucu    ucuuuc cgu cacu uucu guca        ucg u
   ||   |||||||    |||||| ||| |||| |||| ||||        ||| g
3' cc   gaucaga    aggaag gcg guga aaga cagu        agc a
     uuc       ----      a   c    c    -    aagauaua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000048.1: 273544-273640 [-]
intergenic
Database links

Mature sequence ppc-miR-2238e

Accession MIMAT0011719
Sequence

60 - 

aaugacagaacagugcgcgag

 - 80

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).