Stem-loop sequence ppc-mir-2268

AccessionMI0011227 (change log)
DescriptionPristionchus pacificus miR-2268 stem-loop
Stem-loop
   c     -a     c  c          -   c      g    -a     aa 
5'  ggccu  gccca uc ggguaccaau cgc auagug ucau  gaccg  c
    |||||  ||||| || |||||||||| ||| |||||| ||||  |||||   
3'  uugga  cgggu ag uccaugguua gcg ugucac agua  uuggu  g
   -     aa     -  u          u   c      -    ac     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000060.1: 1496021-1496120 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-2268
ppc-mir-2232-2ABKE03000060.1: 1495630-1495749 [+]
ppc-mir-2268ABKE03000060.1: 1496021-1496120 [+]
Database links

Mature sequence ppc-miR-2268

Accession MIMAT0011722
Sequence

60 - 

aaugacacugucgcguauuggu

 - 81

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).