Stem-loop sequence ppc-mir-2247

AccessionMI0011243 (change log)
DescriptionPristionchus pacificus miR-2247 stem-loop
Stem-loop
   -  cu     -u  c  cu     c    cu      u   gacga 
5'  uc  cgauu  ac ga  cuccc auuc  ugugau gcu     c
    ||  |||||  || ||  ||||| ||||  |||||| |||     u
3'  ag  gcuaa  ug cu  gaggg uaag  auacua uga     a
   c  uc     cu  a  cg     a    uu      c   aauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000107.1: 4533559-4533651 [-]
intergenic
Database links

Mature sequence ppc-miR-2247

Accession MIMAT0011735
Sequence

17 - 

ucuccccauuccuugugauugcu

 - 39

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).