Stem-loop sequence dme-mir-2279

AccessionMI0011289 (change log)
DescriptionDrosophila melanogaster miR-2279 stem-loop
Literature search

1 open access papers mention dme-mir-2279
(1 sentences)

Stem-loop
   -   gagagg      aaa     -uu     u         g            u  a 
5'  cgg      auuaug   gacaa   ugaaa uaaauaucu ugugugaaauua uu a
    |||      ||||||   |||||   ||||| ||||||||| |||||||||||| ||  
3'  gcc      uaauau   cuguu   auuuu auuuauaga gcgcacuuuaau ag a
   g   ----aa      -cc     uac     u         a            u  a 
Get sequence
Deep sequencing
419 reads, 2.17 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 2552170-2552282 [-]
sense
FBtr0301779 ; MFS17-RF; intron 2
FBtr0301780 ; MFS17-RG; intron 3
FBtr0301781 ; MFS17-RH; intron 3
Database links

Mature sequence dme-miR-2279-5p

Accession MIMAT0011784
Previous IDsdme-miR-2279*
Sequence

31 - 

uuaaauaucugugugugaaauu

 - 52

Get sequence
Deep sequencing345 reads, 44 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

Mature sequence dme-miR-2279-3p

Accession MIMAT0011785
Previous IDsdme-miR-2279
Sequence

67 - 

uuucacgcgaagauauuuauuu

 - 88

Get sequence
Deep sequencing49 reads, 13 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:19541914 "Abundant primary piRNAs, endo-siRNAs, and microRNAs in a Drosophila ovary cell line" Lau NC, Robine N, Martin R, Chung WJ, Niki Y, Berezikov E, Lai EC Genome Res. 19:1776-1785(2009).
2
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).