Stem-loop sequence bta-mir-2289

AccessionMI0011298 (change log)
DescriptionBos taurus miR-2289 stem-loop
Stem-loop
        cggu  uc              u u c  u     
5' gccuu    ug  gcgcgagcucgggc c g gc cgga 
   |||||    ||  |||||||||||||| | | || ||| u
3' cgggg    ac  ugcgcucgagcuug g c cg gccg 
        ---u  cc              u - u  -     
Get sequence
Deep sequencing
22 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 148643536-148643609 [-]
intergenic
Database links

Mature sequence bta-miR-2289

Accession MIMAT0011796
Sequence

47 - 

ucguguucgagcucgcgucc

 - 66

Get sequence
Deep sequencing20 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).