Stem-loop sequence bta-mir-2489

AccessionMI0011326 (change log)
DescriptionBos taurus miR-2489 stem-loop
Stem-loop
   u       uuca     c   -  a  u      uuu   cu 
5'  guugugu    aauga agg gg ca gaguuu   aau  g
    |||||||    ||||| ||| || || ||||||   |||   
3'  caauaca    uuacu ucc cc gu uucaaa   uug  g
   g       ----     -   u  c  u      --u   ac 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr14: 48380355-48380432 [+]
sense
ENSBTAT00000061009 ; SAMD12-201; intron 4
Database links

Mature sequence bta-miR-2489

Accession MIMAT0011825
Sequence

12 - 

aaaugacaggggacaugaguuu

 - 33

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).