Stem-loop sequence bta-mir-2343

AccessionMI0011371 (change log)
DescriptionBos taurus miR-2343 stem-loop
Stem-loop
   cugacaag   a -   a       ga    aucca  g  u 
5'         gga g ggg gacggug  acuu     ga ug g
           ||| | ||| |||||||  ||||     || ||  
3'         ccu c ccc cugucac  ugga     uu au u
   ------ga   c a   -       ag    ----g  g  g 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 45394335-45394408 [-]
sense
ENSBTAT00000017986 ; EFTUD2-201; intron 15
Database links

Mature sequence bta-miR-2343

Accession MIMAT0011878
Sequence

11 - 

aaggggagacgguggaacuuau

 - 32

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).