Stem-loop sequence bta-mir-2382

AccessionMI0011419 (change log)
DescriptionBos taurus miR-2382 stem-loop
Literature search

1 open access papers mention bta-mir-2382
(1 sentences)

Stem-loop
       cacu   a   -   u  - ug     cu   --  u 
5' gcug    ugu ggg gag gc c  ggaag  guu  cc u
   ||||    ||| ||| ||| || |  |||||  |||  ||  
3' cgac    aca ccc cuc cg g  ccuuc  cag  gg u
       --cc   c   g   -  u gu     au   cc  u 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 1755398-1755474 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-2382
bta-mir-2382chr25: 1755398-1755474 [-]
bta-mir-1842chr25: 1755151-1755210 [-]
Database links

Mature sequence bta-miR-2382-5p

Accession MIMAT0011930
Previous IDsbta-miR-2382
Sequence

12 - 

aggggagugccugggaagcugu

 - 33

Get sequence
Deep sequencing11 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence bta-miR-2382-3p

Accession MIMAT0011931
Previous IDsbta-miR-2382*
Sequence

47 - 

cuacuuccuggugccucgccccac

 - 70

Get sequence
Deep sequencing16 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).