Stem-loop sequence bta-mir-2394

AccessionMI0011434 (change log)
DescriptionBos taurus miR-2394 stem-loop
Stem-loop
        uuc      -caa       a  aac  uu 
5' caggc   uccccu    ucucagg cu   ca  u
   |||||   ||||||    ||||||| ||   ||   
3' guccg   agggga    agagucc ga   gu  u
        -ua      aagg       -  -gu  ua 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr26: 31498704-31498771 [-]
intergenic
Database links

Mature sequence bta-miR-2394

Accession MIMAT0011947
Sequence

6 - 

uucuccccucaaucucaggacu

 - 27

Get sequence
Deep sequencing11 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).