Stem-loop sequence bta-mir-2414

AccessionMI0011460 (change log)
DescriptionBos taurus miR-2414 stem-loop
Stem-loop
               ag   gg         uaug    g 
5' guauuuuguguu  ugc  augguguua    uuaa a
   ||||||||||||  |||  |||||||||    ||||  
3' cguaaaacacga  acg  uaccacaau    aauu c
               -g   aa         -uga    a 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 102657584-102657657 [+]
sense
ENSBTAT00000034295 ; ERI3-202; intron 1
ENSBTAT00000020671 ; ERI3-201; intron 3
Database links

Mature sequence bta-miR-2414

Accession MIMAT0011977
Sequence

7 - 

uguguuagugcggaugguguua

 - 28

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).